GKR-Forum

a_6.jpg a_6.jpg

#1

Genetische Begriffe

in Genetik 01.12.2012 22:07
von franzpeter | 9.651 Beiträge

Genetische Begriff
DNA
Wie erfährt jede Zelle eines lebenden Organismus, was ihre Funktion ist? Wie erfahren die Zellen, die sich zusammentun, um die Guppyhaut zu bilden, dass sie Hautzellen sind; nicht Zellen, die dem Guppy zum Beispiel helfen, seine Nahrung zu verdauen, oder ihm ermöglichtzu atmen? Und wenn der Guppy rot ist, wie erfahren die Hautzellen, dass sie Zellen der Art sind, die Menschen als "rot" sehen?

Die Antworten zu diesen Fragen kommen in der Form von Anweisungen. Diese Anweisungen sind in jeder einzelnen Zelle, in dem Teil der Zelle, den man Nukleus nennt. Die Anweisungen kommen in der Form eines Moleküls, genannt DNA. Dieses Molekül hat die Form einer gedrehten Leiter. Die Sprossen dieser Leiter werden aust 4 Buchstaben, den Buchstaben des DNA-Alphabetes gebildet: A, T, C und G.

Die DNA-Stränge bestehen also aus Buchstaben: ATGCTCGAATAAATGTCAATTTGA

Diese Buchstaben formen "Worte": ATG CTC GAA TAA ATG TCA ATT TGA

Und die "Worte" formen "Sätze": <ATG CTC GAA TAA> <ATG TCA ATT TGA>

Diese "Sätze" werden Gene genannt Diese Gene weisen die Zelle exakt an, was sie zu tun hat.

Codon
Als Codon bezeichnet man die Abfolge einer Sequenz von drei Nukleobasen (Basentriplett) der mRNA, die im genetischen Code für eine Aminosäure codiert. Insgesamt existieren 43 = 64 mögliche Codons, davon sind drei Nonsens-Codons, diese werden zur Termination der Translation genutzt, die restlichen 61 codieren für die insgesamt 20 proteinogenen Aminosäuren. Für viele Aminosäuren gibt es daher mehrere verschiedene Kodierungen. Die Kodierung als Triplett ist trotzdem notwendig, da bei einer Duplett-Kodierung nur 42 = 16 mögliche Codons entstehen würden, und somit nicht genügend Möglichkeiten vorhanden wären, um alle 20 Aminosäuren abzudecken.

Intron/Extron
Introns (Intervening regions) sind die nicht codierenden Abschnitte der DNA innerhalb eines Gens (intragen), die benachbarte Exons trennen. Introns werden transkribiert, aber dann aus der prä-mRNA herausgespleißt, bevor diese zur Translation aus dem Zellkern herausgeschleust wird. Die in der reifen mRNA verbleibenden Teile des Gens nennt man Exons. Die Aufteilung des Gens in Intron und Exon gehören zu den Hauptcharakteristika von eukaryotischen Zellen.

Exon
Ein Exon (von engl. expressed region) ist der Teil eines eukaryotischen Gens, der nach dem Spleißen (Splicing) erhalten bleibt und im Zuge der Protein-Biosynthese in ein Protein translatiert werden kann. Dem gegenüber stehen die Introns (von engl. intervening region) die beim Spleißen herausgeschnitten und abgebaut werden.

Die Gesamtheit der Exons eines Gens enthält also die genetische Information, die sich in Proteinen manifestiert, also den offenen Leserahmen oder ORF (engl. open reading frame).

Primer
Als Primer (Pl.: die Primer, IPA: [ˊpʁaɪ̯mɐ]) wird in der Molekularbiologie ein Oligonukleotid bezeichnet, das als Startpunkt für DNA-replizierende Enzyme wie die DNA-Polymerase dient.

[bearbeiten]Ribosom
Ribosomen (von griech. Αραβινόζ, arabinos, „Traube“ und σωμα, soma, „Körper“) sind Komplexe aus Proteinen und Ribonukleinsäuren (RNA), die im Cytoplasma der Zellen von Lebewesen vorkommen. An ihnen werden Proteine hergestellt, und zwar entsprechend der Basensequenz der DNA, die die Information zur Aminosäuresequenz der Proteine enthält.

Nukleotid
Ein Nukleotid ist ein Molekül, das als Grundbaustein von Nukleinsäuren (DNA und RNA) fungiert und auch im genetischen Code verwendet wird. Außerdem haben viele Arten von Nukleotiden lebensnotwendige regulatorische Funktionen in Zellen, beispielsweise das ATP, das cAMP und das GTP.

Die Riesenmoleküle DNA und RNA sind aus insgesamt fünf verschiedenen Sorten von Nukleotiden zusammengesetzt, die in beliebiger Reihenfolge mit Hilfe von Atombindungen zum jeweiligen Makromolekül verknüpft werden können. Die dabei ablaufende Reaktion ist eine Kondensationsreaktion. Drei miteinander verbundene Nukleotide bilden die kleinste Informationseinheit, die in der DNA und RNA zur Kodierung der genetischen Information zur Verfügung steht. Man nennt diese Informationseinheit ein Codon.

Promotor
Als Promotor, auch Promoter (ursprünglich franz. promoteur, Anstifter, Initiator), wird in der Genetik eine DNA-Sequenz bezeichnet, die die regulierte Expression eines Gens ermöglicht. Die Promotorsequenz ist ein essenzieller Bestandteil eines Gens. Sie liegt am 5'-Ende und somit vor dem RNA-kodierenden Bereich. Die wichtigste Eigenschaft eines Promotors ist die spezifische Wechselwirkung mit bestimmten DNA-bindenden Proteinen, welche den Start der Transkription des Gens durch die RNA-Polymerase vermitteln und als Transkriptionsfaktoren bezeichnet werden.

[bearbeiten]Enzyme
Enzyme (altgriechisches Kunstwort ἔνζυμον, énzymon), sind Proteine, die biochemische Reaktionen steuern. Enzyme haben Funktionen im Stoffwechsel aller Organismen: Sie steuern den überwiegenden Teil biochemischer Reaktionen.

Peptid
Ein Peptid ist ein kleines Protein. Es handelt sich um eine organische chemische Verbindung, die aus einer Verknüpfung mehrerer Aminosäuren entstanden ist[1]. Dabei sind die einzelnen Aminosäuren in einer definierten Reihenfolge (Sequenz) zu einer, meist unverzweigten, Kette verbunden. Die Aminosäuren in Peptiden und in den größeren Proteinen sind über Amidbindungen miteinander verbunden. Wegen der großen Bedeutung der Peptide in der Biochemie und organischen Chemie wird diese Bindung heute nur noch Peptidbindung genannt. Peptide unterscheiden sich von Proteinen allein durch ihre Größe, d. h. Anzahl der verknüpften Aminosäuren, also ihrer Molaren Massen. Die Definition, ab wann Peptide in Proteine übergehen, ist unscharf; ab ungefähr 100 verknüpften Aminosäuren wird das Molekül als Protein bezeichnet.

Thymin
Thymin (T), auch 5-Methyluracil, ist als einer der Nukleinbasen ein Grundbaustein der DNA. Es ist wie Cytosin ein Pyrimidin-Derivat und tritt in der DNA als Nukleotid Thymidin glycosidisch an Desoxyribose gebunden auf. Zur komplementären Nukleinbase Adenin bildet es zwei Wasserstoffbrücken. In der RNA kommt Thymin nur sehr selten vor (z. B. in der t-RNA) und ist dort in aller Regel durch Uracil ersetzt.

[bearbeiten]Cytosin
Cytosin ist ein Pyrimidin-Derivat und eine der Nukleinbasen. Sie kommt sowohl in der Desoxyribonukleinsäure als auch in der Ribonukleinsäure vor. Als Nukleosid glycosidisch an Ribose gebunden tritt es als Cytidin, an Desoxyribose gebunden als Desoxycytidin auf.

Adenin
Adenin ist eine der vier organischen Komplementärbasen der Desoxyribonukleinsäure (DNA) und der Ribonukleinsäure (RNA). Es ist aber auch in anderen biologisch bedeutsamen Molekülen vorhanden, so im Adenosintriphosphat.

[bearbeiten]Guanin
Guanin ist als eine der vier Nukleinbasen Grundbaustein von DNA und RNA; es ist aber auch in anderen biologisch bedeutsamen Molekülen vorhanden, beispielsweise im Guanosintriphosphat (GTP).

Uracil
Uracil ist eine Pyrimidin-Base. Sie ist Bestandteil der Ribonukleinsäure (RNA). Uracil kommt im Körper hauptsächlich an Ribosephosphat gebunden in Form der Nukleotide Uridinmonophosphat (UMP), Uridindiphosphat (UDP) und Uridintriphosphat (UTP) vor.

Hypoxanthin
Hypoxanthin ist ein natürlich vorkommendes Purinderivat und entsteht bei der Einwirkung der Xanthinoxidase auf Xanthin obwohl der Purinabbau normalerweise so abläuft, dass Hypoxanthin durch Xanthinoxidase zu Xanthin oxidiert wird. Sehr selten bildet Hypoxanthin das Grundgerüst von Nukleinsäuren. Es ist im Anticodon der tRNA enthalten in der Form des Nukleotids Inosin.

[bearbeiten]Xanthin
Xanthin ist ein Zwischenprodukt beim Purin-Abbau und wird durch die Xanthinoxidase in Harnsäure umgewandelt.

Protein
Proteine, umgangssprachlich auch Eiweiße genannt, sind aus Aminosäuren aufgebaute Makromoleküle. Proteine gehören zu den Grundbausteinen aller Zellen. Sie verleihen der Zelle nicht nur Struktur, sondern sind die molekularen „Maschinen“, die Stoffe transportieren, Ionen pumpen, chemische Reaktionen katalysieren und Signalstoffe erkennen. Die Gesamtheit aller Proteine in einem Lebewesen, einem Gewebe, einer Zelle oder einem Zellkompartiment, unter exakt definierten Bedingungen und zu einem bestimmten Zeitpunkt, wird als Proteom bezeichnet.




Gene
Gene bilden die Bedienungsanleitungen für lebende Organismen. Gene bestehen aus DNA. Ein DNA-Strang enthält viele Gene. All diese Gene müssen Anweisungen erteilen, wie alle Teile des Organismus zusammenzusetzen sind, und auf, wie sie ihre Arbeiten zu verrichten haben.

Locus
Locus (lat: Ort pl.: Loci) bzw. Genlocus (Genort) nennt man die Lage, also physikalische Position eines Gens im Genom. Besteht das Genom aus mehreren Chromosomen, ist die Position innerhalb des Chromosoms gemeint, auf dem sich das Gen befindet. Verschiedene Ausprägungen oder Varianten dieses Gens werden als Allele bezeichnet, die sich alle an derselben Stelle auf dem Chromosom, nämlich dem Genort befinden. Der Begriff entstand bei der Erstellung der ersten Genkarten und ist verknüpft mit der Erkenntnis, dass Gene eine bestimmte Anordnung auf den Chromosomen haben.

Chromosomen
Jede Körperzelle enthält viel DNA. In der Tat, wenn du die DNA einer einzelnen menschlichen Zelle herausausziehen und strecken könntest, wäre sie drei Meter lang! Dieser ganze DNA paßt in eine Zelle, weil die DNA in kompakte Chromosomen genannte Lagerungseinheiten verpackt ist.

Jede Zelle eines Guppys hält 46 Chromosomen, die in 2 Sätzen zu 23 organisiert sind. Jedes Paar der entsprechenden Chromosome bilden einen Satz. In jedem Satz kommt 1 Chromosom vom Vater und eines von der Mutter. Einer der 23 Sätze enthält die Chromosomen, die das Geschlecht bestimmen. Ein Männchen hat ein Y-Chromosom und ein X-Chromosom. Ein Weibchen hat einen Satz von 2 X-Chromosomen.

[bearbeiten]Allel
Eine alternative Form eines Gens, die auf dem gleichen Locus (Ort) auf dem Chromosom liegt. Zum Beispiel ist das Grundfarbe-Gold-Gen ein Allel des Gens Grundfarbe Grau.

Genotyp
Der Genotyp oder das Erbbild eines Organismus repräsentiert seine exakte genetische Ausstattung, also den individuellen Satz von Genen, den er im Zellkern in sich trägt. Der Begriff Genotyp wurde 1909 von dem dänischen Genetiker Wilhelm Johannsen geprägt.

Die genetische Information der gesamten Zelle wird als Idiotyp (Idiotypus) bezeichnet. Zwei Organismen, deren Gene sich auch nur an einem Locus (der Position in ihrem Genom) unterscheiden, haben einen unterschiedlichen Genotyp. Der Begriff „Genotyp“ bezieht sich also auf die vollständige Kombination aller Allele / aller Loci eines Organismus

Karyotyp
Der Karyotyp bezeichnet in der Zytogenetik die Gesamtheit aller zytologisch erkennbaren Chromosomeneigenschaften eines Individuums oder einer Gruppe genetisch verwandter Individuen. Zu diesen Eigenschaften gehören die Anzahl der Chromosomen einer Zelle ebenso wie ihre Ausbildung, die relative und die absolute Größe, die Lage des Zentromers, Sekundäreinschnürungen, spezifische Bandenmuster sowie die Chromatinverteilung im Chromosom.

Der Karyotyp wird bestimmt, in dem Chromosomen in der Metaphase der Mitose über Chromosomenfärbungen erkennbar gemacht und lichtmikroskopisch untersucht werden.

Phänotyp
Der Phänotyp oder das Erscheinungsbild ist die Summe aller Merkmale eines Individuums. Er bezieht sich nicht nur auf morphologische, sondern auch auf physiologische Eigenschaften.

Im Phänotyp spiegeln sich auch erworbene Eigenschaften wider, etwa vergrößerte oder verkümmerte Muskelgruppen, je nach häufigerem oder weniger häufigem Gebrauch, Zwergwuchs durch widrige Umweltbedingungen etc. Solche erworbenen Eigenschaften werden nicht weitervererbt, der Genotyp wird dadurch nicht beeinflusst.

[Populationsgenetik
Die Populationsgenetik ist die Erforschung der Verteilung von Genfrequenzen unter dem Einfluss von vier Evolutionsfaktoren (daher manchmal auch Evolutionsgenetik genannt):

Selektion
Gendrift
Mutation und Rekombination
Migration oder Isolation
Sie zieht ebenso die Populationsstruktur, z. B. die weitere Unterteilung einer Population in räumlich begrenzte Subpopulationen, in Betracht. Sie ist somit die Theorie, die natürliche Anpassung und Artbildung beschreibt. Die Populationsgenetik war somit notwendiger Bestandteil der modernen Synthese mit ihren Gründern, Sewall Wright, J. B. S. Haldane und Ronald Fisher, die auch die Grundlagen für die quantitative Genetik legten.

Die Populationsgenetik untersucht quantitativ, wie sich die ökologischen Interaktionen auf die genetische Zusammensetzung von Populationen auswirken und welche Rückwirkungen dies auf die ökologischen Eigenschaften der Population haben kann. Populationsgenetik untersucht die Gesetzmäßigkeiten, die Evolutionsprozessen zugrunde liegen.

[bearbeiten]Selektion
Selektion (lat. selectio „Auswahl“) ist ein grundlegender Begriff der Evolutionstheorie. Sie besteht

1.als natürliche Selektion in der Reduzierung des Fortpflanzungserfolgs bestimmter Individuen einer Population mit der Folge, dass andere Individuen, die im Rückblick als „überlebenstüchtiger“ erkennbar sind, sich stärker vermehren. Die entscheidenden Einflüsse üben äußere Faktoren der Umwelt, sog. Selektionsfaktoren, aus. „Überlebenstüchtigkeit“ (Fitness) bedeutet nicht das "Überleben der Stärksten". Sie kann auch Kooperation und Altruismus einschließen. Entscheidend ist, dass die Erbanlagen von Individuen nicht mit der gleichen Wahrscheinlichkeit weitergegeben werden.
2.als sexuelle Selektion in der Auswahl von Individuen durch die Sexualpartner. Entscheidend ist, dass Erbanlagen derjenigen Merkmale weitergegeben werden, die von den Sexualpartnern bevorzugt werden.
3.als künstliche Selektion in einer vom Menschen gesteuerten Zuchtwahl. Sie steigert den Fortpflanzungserfolg jener Individuen, die die vom Züchter geförderten Eigenschaften besitzen.
Der Begriff der natürlichen Selektion wurde von Charles Darwin geprägt. Die Selektionstheorie ist ein Aspekt seiner Evolutionstheorien und wurde als wesentlicher Teil der Synthetischen Evolutionstheorie in die moderne Evolutionsbiologie übernommen. Selektion ist einer der Evolutionsfaktoren.

Mutation
Eine Mutation (v. lat. mutatio „Veränderung“, „Wechsel“) ist eine Veränderung des Erbgutes eines Organismus durch Veränderung der Abfolge der Nukleinbasen oder durch Veränderung der Chromosomenzahl, die nicht auf Rekombination oder Segregation beruht. Dieser Begriff wird daher nur für einen Teilbereich aller möglichen Chromosomenaberrationen verwendet. Durch eine Mutation wird die in der DNA gespeicherte Information verändert und dadurch können einzelne Merkmale (der Phänotyp) verändert werden.

Das „durchschnittliche Ausmaß“ der Mutationen bei der Vererbung innerhalb einer Population nennt man Diversifikation.

Rekombination
Unter Rekombination versteht man in der Biologie im engeren Sinne den Austausch von Allelen und im Allgemeinen die Verteilung und Neuanordnung von genetischem Material (DNA, RNA). Durch Rekombination kommt es zu neuen Gen- und Merkmalskombinationen. Rekombination und Mutation verursachen die genetische Variabilität innerhalb einer Population. Die genetische Variabilität ist wiederum die Basis für die Anpassung an wechselnde Umweltbedingungen im Evolutionsprozess.
Migration
Als Migration bezeichnet die Populationsgenetik die Ein- und Abwanderung von Individuen zwischen verschiedenen Populationen einer Art. Dadurch findet ein Austausch zwischen den einzelnen Genpools der Populationen statt (Genfluss). Ist die Migrationsrate hoch genug, kann die Inzucht und die Homozygotie kleiner Populationen verringert werden und auch die Auswirkungen der Genetischen Drift werden durch Migration reduziert.

Genfluss
Genfluss ist ein Begriff aus der Evolutionsbiologie. Unter Genfluss versteht man den Austausch genetischen Materials zwischen zwei Populationen einer Art.

Wird der Genfluss verhindert, z. B. durch geographische Isolation, so entwickeln sich die Populationen unterschiedlich. Es kann zu einer allopatrischen Artbildung kommen.

Gendrift
Als Gendrift (das niederdeutsche Drift ist verwandt mit dem deutschen treiben) (auch Alleldrift oder Sewall-Wright-Effekt) bezeichnet man in der Populationsgenetik eine zufällige Veränderung der Genfrequenz innerhalb des Genpools einer Population. Gendrift ist ein Evolutionsfaktor.

Gendrift stellt eine Art Komplement zur natürlichen Selektion dar. Die natürliche Selektion hat keinen zufälligen Einfluss auf die Änderung der Genfrequenz einer Population, sondern ist direkt gekoppelt an den Überlebens- und Reproduktionserfolg von Individuen, also deren Angepasstheit an ihre Umwelt.[1] Die genetische Drift hat keine derartigen Ursachen, sondern ist rein zufallsbestimmt.

Geschlechtsgebunden
Ein Gen, das an das X- oder Y-Chromosom gebunden ist. Ein Y-gebundenes Gen kann nur durch das Männchen weitergegeben werden.

Autosomal
Gene die nicht geschlechtsgebunden sind. Autosomale Gene werden ohne Rücksicht auf das Geschlecht ihres Trägers weitergegeben.

Dominanz
Ein Gen, dass die Merkmale eines rezessiven Allels aufhebt ist zu diesem dominant. Zum Beispiel ist Grau die dominante Grundfarbe des Guppys. Wenn das Grau-Gen mit einem seiner rezessiven Allele gepaart ist, z. B. mit Gold, Dann zeigt sich die graue Farbe und nicht die Gold-Farbe. Grau ist dominant über Gold.

Intermediär
Der Ausdruck intermediär kommt vom lateinischen intermedius - der dazwischenliegende. In der Genetik wird zwischen dominant/rezessiver und intermediärer Vererbung unterschieden. Beide Varianten kommen dann vor, wenn heterozygotes Erbgut vorliegt, also das Gen für ein bestimmtes Merkmal in zwei unterschiedlichen Varianten (Allelen) vorliegt. Beim dominant/rezessiven Erbgang setzt sich allein das dominante Allel im Erscheinungsbild (im Phänotyp) durch. Bei intermediärer Vererbung hingegen kommt es zu einer gemischten Merkmalsausprägung, die von beiden Allelen beeinflusst wird.

Epistase
Epistase (Griechisch für bremsen, stoppen) ist eine Form der Gen-Interaktion. Sie liegt vor, wenn ein Gen die Unterdrückung der phänotypischen Ausprägung eines anderen Gens bewirken kann. Der Begriff wurde im Jahre 1909 von William Bateson eingeführt.

Es gibt dominante und rezessive Epistase. Kontrolliert ein einziges Gen mehrere phänotypische Merkmale, so spricht man von Pleiotropie.

Achtung: Heutzutage wird der Begriff "Epistase" oft allgemein für Gen-Gen-Interaktionen verwendet. Die Definition nach Bateson entspricht der klassisch-genetischen Definition.

Zygote
Eine Zygote ist eine befruchtete Eizelle (diploid), die durch Verschmelzung zweier haploider Geschlechtszellen (Gameten) entsteht – meistens aus einer Eizelle (weiblich) und einem Spermium (männlich). Bei diesem als Befruchtung bezeichneten Vorgang verschmelzen zunächst beide Membranen (Plasmogamie) und dann auch die Zellkerne der beiden Geschlechtszellen (Karyogamie). Den gesamten Verschmelzungsvorgang nennt man Syngamie. Sobald die Samenzelle in die Eizelle eingedrungen ist, findet die Rindenreaktion statt, bei der die Eizelle eine Substanz ausscheidet, die es für weitere Samenzellen unmöglich macht, in die Eizelle einzudringen. Bei Mehrzellern entstehen aus der Zygote durch vielfache Mitosen (Kernteilungen) mehrzellige Organismen.

Diploid
Unter Diploidie (von griech. diploe = Doppeltheit) wird in der Genetik das Vorhandensein zweier vollständiger Chromosomensätze als sogenannter doppelter Chromosomensatz verstanden. Jedes Chromosom liegt somit in doppelter Zahl vor, wobei bei den Gonosomen männlicher Individuen nicht zwischen den an und für sich unterschiedlichen X- und Y-Chromosomen unterschieden wird.

Haploid
Unter Diploidie (von griech. diploe = Doppeltheit) wird in der Genetik das Vorhandensein zweier vollständiger Chromosomensätze als sogenannter doppelter Chromosomensatz verstanden. Jedes Chromosom liegt somit in doppelter Zahl vor, wobei bei den Gonosomen männlicher Individuen nicht zwischen den an und für sich unterschiedlichen X- und Y-Chromosomen unterschieden wird.

Nachdem dies beim Menschen sowie bei vielen Tieren und Pflanzen der übliche Zustand ist, wird dies auch als Euploidie bezeichnet. Es gibt aber auch Ausnahmen, z. B. aufgrund von Generationszyklen oder verschiedener Geschlechter.

Heterozygot
Wie im obigen Beispiel kann ein Guppy die Gene für Grau und Gold am gleichen Locus gepaart haben. Man sagt dann, der Guppy ist heterozygot für Gold. Der Guppy besitzt das Gold-Gen, obwohl er es nicht ausprägt.

Homozygot
Wenn der Guppy z.B. zwei Gene für Gold auf dem gleichen Locus besitzt, sagt man, dass er homozygot für Gold ist. Da es dann kein dominantes Gen gibt, das das rezessive Merkmal Gold aufheben kann, wird der Guppy tatsächlich die Grundfarbe Gold ausprägen.

Rezessiv
Ein Gen (oder ein Allel), dessen Merkmale nicht ausgeprägt werden, wenn es zusammen mit einem dominanten Gen auftritt. Im obigen Beispiel ist das Gen für die Grundfarbe Gold rezessiv. Wenn es zusammen mit dem Gen für Grau auftritt, wird Gold nicht ausgeprägt, obwohl das Gen für Gold vorhanden ist. Rezessive Merkmale zeigen sich nur, wenn ihr Träger homozygot für diese Merkmale ist.

Crossing over
Unter einem Chromosomalen Crossing-over (auch interchromosomale Rekombination) versteht man in der Genetik einen Faktoren- oder Stückaustausch, der zwischen homologen Chromosomen während der Prophase I im Pachytän der Meiose stattfindet.

Centromer
Als Centromer oder Zentromer (von griechisch κέντρον kéntron "Mittelpunkt"; und griechisch μέρος méros "Teil") bezeichnet man den Bereich der primären Konstriktion (Einschnürungsstelle) eines Metaphase-Chromosoms. Hier hängen die beiden Chromatiden zusammen, bis sie während der Kernteilung (Mitose oder zweite meiotische Teilung) am Beginn der Anaphase getrennt werden: An den sich am Centromer ausbildenden Proteinkomplexen, den Kinetochoren, setzen die Fasern des Spindelapparates an, die die Schwesterchromatiden zu den entgegengesetzten Zellpolen ziehen. Das Centromer teilt das Chromosom häufig in zwei, manchmal unterschiedlich lange, Arme.

Penetranz
In der Genetik wird unter Penetranz die prozentuale Wahrscheinlichkeit verstanden, mit der ein bestimmter Genotyp den zugehörigen Phänotyp in einer Population beziehungsweise Geschwisterreihe ausbildet. Es werden eine vollständige Penetranz, bei der es immer zur Ausprägung des Merkmals kommt, von einer unvollständigen Penetranz unterschieden. Hintergrund einer unvollständigen Penetranz (<100%) können modifizierende Gene, Umwelteinflüsse oder auch der Zufall sein. Der Grad mit dem sich ein penetrantes Gen als Merkmal im Phänotyp ausprägt ist, wird in der Genetik als Expressivität bezeichnet.

Pleiotropie
Pleiotropie (pleio: griechisch = voll und trop: griechisch = Drehung, Wendung) oder Polyphänie ist ein Begriff aus der Biologie und der Genetik. Darunter versteht man die Veränderung mehrerer phänotypischer Merkmale, die durch ein einzelnes Gen hervorgerufen wird. Das Gegenstück hierzu ist die Polygenie.

Die Ursache für pleiotrope Erscheinungen ist in den Transkriptions- und Translationsprodukten zu suchen. Zum Beispiel ist beim Albino Guppy sowohl Größe als auch Farbe betroffen.

SDR
Sex Determining Region= ein Teil des Y-Chromosoms, wo das Geschlecht des Guppys bestimmt wird.Hier angesiedelte männliche Merkmale haben selten ein Crossing over. Das Moskauer Merkmal ist ein Beispiel dafür.


Mit freundlichen Grüßen
franzpeter
zuletzt bearbeitet 27.07.2015 15:11 | nach oben springen
lockDas Thema wurde geschlossen.


Besucher
0 Mitglieder und 9 Gäste sind Online

Wir begrüßen unser neuestes Mitglied: JasperBassler
Forum Statistiken
Das Forum hat 2559 Themen und 13279 Beiträge.

Heute waren 0 Mitglieder Online:

Besucherrekord: 71 Benutzer (12.03.2015 19:47).

Xobor Einfach ein eigenes Forum erstellen | ©Xobor.de